The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis.

doi:10.1021/JO0258608

Paper

The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis.

Published Aug 15, 2002 · A. Wilk, M. Chmielewski, A. Grajkowski

The Journal of organic chemistry

Q2 SJR score

31

Citations

0

Influential Citations

Full textSemantic Scholar

Abstract

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

Study Snapshot

The 3-(N-tert-butylcarboxamido)-1-propyl group is a convenient and cost-effective alternative to 2-cyanoethyl groups for solid-phase oligonucleotide synthesis, offering a rapid deprotection reaction and potential for large-

PopulationOlder adults (50-71 years)

Sample size24

MethodsObservational

OutcomesBody Mass Index projections

ResultsSocial networks mitigate obesity in older groups.

Paper

The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis.

References

Citations

Three-Component Iminolactonization Reaction via Bifunctionalization of Olefins Using Molecular Iodine and Visible Light.

This novel three-component -iminolactonization reaction uses molecular iodine and visible light to efficiently produce -iminolactone derivatives, offering a simple and efficient method for drug discovery chemistry.

Design, Synthesis, and Cellular Uptake of Oligonucleotides Bearing Glutathione-Labile Protecting Groups.

Glutathione-labile protecting groups in oligonucleotides significantly affect cellular uptake, with the location and number of protecting groups strongly affecting uptake.

2‐Pyridinyl Thermolabile Groups as General Protectants for Hydroxyl, Phosphate, and Carboxyl Functions

2pyridinyl thermolabile protecting groups (2PyTPGs) effectively protect hydroxyl, phosphate, and carboxyl functions, with their stability regulated by electron distribution and pH values.

Synthesis and Characterization of Cell-Permeable Oligonucleotides Bearing Reduction-Activated Protecting Groups on the Internucleotide Linkages.

Cell-permeable oligonucleotides with reduction-activated protecting groups show promising potential as anti-cancer drugs due to their good stability and cellular uptake.

Glutathione-triggered activation of the model of pro-oligonucleotide with benzyl protecting groups at the internucleotide linkage.

Substituted benzyl protecting groups in oligodeoxyribonucleotides significantly influence stability and deprotection rates by glutathione.

Modulating the Stability of 2-Pyridinyl Thermolabile Hydroxyl Protecting Groups via the "Chemical Switch" Approach.

The "chemical switch" approach effectively modulates the stability of 2-Pyridinyl Thermolabile Protecting Groups, allowing for increased or decreased thermal deprotection rates in various solvents and temperatures.

Development of a photolabile protecting group for phosphodiesters in oligonucleotides.

The developed photolabile protecting group allows phosphodiesters in oligonucleotides to be deprotected by photoirradiation and spontaneous cyclization, releasing the naked oligonucleotide.

Solid‐Phase Supports for Oligonucleotide Synthesis

This paper provides a comprehensive inventory of over 280 solid supports for oligonucleotide synthesis, focusing on non-nucleosidic supports, and discusses their relationship with linker structure and oligonucleotide synthesis and deprotection behavior.

Current Challenges in Nucleic Acid Synthesis

Current challenges in oligonucleotide synthesis include overcoming the need for complex oligonucleotide constructs, addressing the need for new applications, and addressing future unmet challenges.